Search Results
| Search type | Search syntax |
|---|---|
| Tags | [tag] |
| Exact | "words here" |
| Author |
user:1234 user:me (yours) |
| Score |
score:3 (3+) score:0 (none) |
| Answers |
answers:3 (3+) answers:0 (none) isaccepted:yes hasaccepted:no inquestion:1234 |
| Views | views:250 |
| Code | code:"if (foo != bar)" |
| Sections |
title:apples body:"apples oranges" |
| URL | url:"*.example.com" |
| Saves | in:saves |
| Status |
closed:yes duplicate:no migrated:no wiki:no |
| Types |
is:question is:answer |
| Exclude |
-[tag] -apples |
| For more details on advanced search visit our help page | |
Results tagged with dna
Search options not deleted
user 27752
1
vote
DNA pset6 - Unable to calculate maximum STR repeats in DNA file
Maybe your "repeats" is not doing what you think it's doing? Try this:
string = "ACTGTCTCTCTGGCTGCTAA"
substring = "CT"
repeats = [0] * len(string)
print(repeats)
for i in range(len(string)-len(subst …
- 165
1
vote
Accepted
Pset6, DNA - Convert all columns in a list to integers, skipping the first column
Without answering your question directly (i.e. how to convert to int), let me point out that your csv_list is not actually a list. If you run a print(type(csv_list)) as a sanity check, you'll see it s …
- 165